Medio Ambiente y Desarrollo Sustentable  
Artículo arbitrado  
Antibacterial activity of mexican oregano essential  
oil (Lippia berlandieri) against the phytopathogenic  
bacterium Xanthomonas euvesicatoria  
Actividad antibacteriana del aceite esencial de orégano (Lippia berlandieri)  
contra la bacteria fitopatógena Xanthomonas euvesicatoria  
1
3,4  
2
ALBA CHAVEZ-DOZAL , HUGO A. MORALES-MORALES , SOUM SANOGO ,  
3
1
ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH  
Recibido: Febrero 11, 2011  
Aceptado: Enero 11, 2012  
Abstract  
Resumen  
Xanthomonas euvesicatoria causes bacterial spot disease in  
leaves, roots, fruits and stems of pepper plants. Identification  
of this phytopathogen in jalapeno seeds from Delicias,  
Chihuahua, Mexico and diseased plants from New Mexico,  
USA, was carried out by isolation on semiselective media,  
pathogenicity assays and biochemical tests. Mexican oregano  
Xanthomonas euvesicatoria es la bacteria agente causal de la  
marchitez bacteriana en hojas, raíces y frutos de chile jalapeño. Se  
realizó la identificación de este patógeno en las semillas de chile  
jalapeño provenientes de Delicias, Chihuahua, México y plantas  
enfermas provenientes del estado de Nuevo Mexico, EUA; a través  
de cultivo en medios semi-selectivos, ensayos de patogenicidad y  
pruebas bioquímicas. El aceite esencial del orégano mexicano  
(Lippia berlandieri) fue probado in vitro contra Xanthomonas  
euvesicatoria. Pruebas de concentración mínima inhibitoria (CMI) y  
concentración mínima bactericida (CMB) fueron determinadas y el  
aceite mostró una inhibición de crecimiento a concentraciones de  
0.01 mg/ml y un efecto bactericida a concentraciones de 0.05 mg/  
ml. El aceite esencial de orégano muestra actividades  
antibacterianas gracias al efecto de la alta concentración de  
carvacrol. El aceite de orégano mostró una CMI que fue 10 veces  
menor en comparación con el efecto de carvacrol puro, ya que la  
concentración determinada en el aceite por medio de cromatografía  
de gases/espectrometría de masas (GC/MS) fue de 30% de  
carvacrol. El efecto antibacteriano in vivo fue probado utilizando un  
diseño de bloques completos al azar en un invernadero. La severidad  
e incidencia de la enfermedad, así como los índices de clorofila,  
fueron calculados mostrando una inhibición de la enfermedad cuando  
las semillas u hojas de las plantas de chile se trataron con el aceite  
de orégano. Estos resultados demuestran la problemática de la  
bacteria Xanthomonas en las fronteras México-Americanas y que  
el aceite esencial de orégano ejerce una acción antibacteriana.  
(
Lippia berlandieri) essential oil was tested in vitro against  
Xanthomonas euvesicatoria. Minimum inhibitory concentration  
MIC) and minimum bactericidal concentration (MBC) were  
(
performed and the oil showed an inhibition of bacterial growth  
in concentrations of 0.01 mg/ml and a bactericidal effect in  
concentrations of 0.05 mg/ml. Oregano essential oil is reported  
to have antimicrobial activities due to the effect of high content  
of carvacrol. Oregano oil had an MIC that was 10 times lower  
compared to pure carvacrol, since carvacrol content,  
measured by gas chromatography/mass spectrometry (GC/  
MS) was only 30%. The antimicrobial effect in vivo was tested  
using a randomized complete block design model in a  
greenhouse. Disease severity, xanthomonad incidence as well  
as chlorophyll indices were calculated showing a strong  
inhibition of the disease, when seeds or foliage were treated  
with oregano oil. These results demonstrate the current  
commonality of xanthomonad pathogens on both sides of the  
Mexican-American border, and that oregano oil has potent  
antibacterial activity.  
Keywords: bacterial spot, minimim inhibory concentration,  
Carvacrol.  
Palabras clave: marchitez bacteriana, concentración mínima  
inhibitoria, Carvacrol.  
_
________________________________  
1
2
3
4
Biology Department, New Mexico State University, Las Cruces, New Mexico, USA.  
Enthomology, Plant pathology and Weed science Department, New Mexico State University, Las Cruces, New Mexico, USA.  
Facultad de Ciencias Agricolas y Forestales, Universidad Autonoma de Chihuahua, Chihuahua, Mexico.  
Dirección electrónica del autor de correspondencia: hugmoral2@yahoo.com.  
1
09  
•
Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •  
ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of  
mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria  
Introduction  
anthomonas euvesicatoria, also called Xanthomonas campestris pv. vesicatoria, has  
been identified as the causal agent of the disease known as bacterial leaf spot  
X
(Pohronesny et al., 1990; Bouzar et al., 1994; Kuflom and Diane, 1997; Ji-Liang and  
Orser, 2004). Bacterial spot is a destructive disease of pepper in climates with high  
temperatures and frequent rainfall (Pohronesny et al., 1990; Vorholter et al., 2008); seeds can  
be infested and serve as a major source of inoculum for bacterial spot, as well as the means  
for the long distance spread of the pathogen (Kuflom and Diane, 1997; Sanogo and Clary,  
2008).  
Bacterial leaf spot can cause serious yield  
Since ancient times, plant extracts including  
essential oils, have been used for a wide variety  
of purposes including their use as antimicrobials  
(Aureli et al., 1992; Biondi et al., 1993; Dorman  
and Deans, 2000; Chorianopupolos et al., 2004;  
Chorianoupolos et al., 2006). Essential oils have  
been screened for their potential applications as  
alternative remedies for many infectious  
diseases, and have been shown to possess  
antibacterial, antifungal, antiviral, insecticidal and  
antioxidant properties (Dorman and Deans,  
loss in pepper crops through plant defoliation  
and fruit drop (Sanogo and Clary, 2008). This  
disease has a major economic impact in both  
the United States and Mexico. In northern  
Mexico, the disease has had an effect on quality  
and quantity of the fruit, resulting in a significant  
impact on market standards causing loses  
greater than nine million U.S. dollars (Velasquez-  
Valle and Amador-Ramirez, 2007).  
Factors such as humidity, rainfall and wind  
play an important role in the occurrence of  
bacterial spot. It has also been reported that the  
pathogen can survive on dried seeds for many  
years and in infected crop debris in the soil  
2000). Mexican oregano (Lippia berlandieri) has  
been proven to show in vitro potent antimicrobial  
activity (Portillo-Ruiz et al., 2005). The  
monoterpenic phenol carvacrol is the main  
constituent of commercial oreganos and should  
be given special emphasis since it  
demonstrates low toxicity and surprisingly broad  
antimicrobial activity (Chorianoupolos et al.,  
(
Andrade et al., 2008). At present, disease  
management practices using either antibiotics or  
pesticides, have been banned due to their  
undesirable attributes such as long degradation  
time, bioaccumulation and chronic and acute  
toxicity (Baricevic et al., 2001;Abbasi et al., 2002).  
Other treatments that have been used recently  
include copper sprays and plant activators  
2006). This simple molecule is promising for the  
development of effective disease treatment not  
only in humans, but also for animals and plants  
(
Veldhuzen et al., 2001). Mexican oregano is  
mainly composed of carvacrol; however, the  
antimicrobial activity is also attributed to other  
phenolic compounds found in the oil such as  
thymol and cymene (Vernin et al 2001), and  
potent antibacterial activity might be attributed  
to a synergistic action of these compounds.  
(
Abbasi et al., 2002), which are effective but  
sometimes induce systematic resistance. In  
addition to the toxic effects in the treatment of  
infectious plant diseases, pharmaceutical  
antibiotics are simple substances that show  
single modes of action and microbial resistance  
is easily developed (Elgayyar and Draughon,  
Few studies have focused on documenting  
the effectiveness of essential oil obtained from  
the Mexican oregano Lippia species. The main  
goal of this investigation was to evaluate the  
antimicrobial effect of Lippia berlandieri  
essential oil on in vitro MIC’s and in vivo against  
2
001). Neither the use of antibiotics nor pesticides  
provides satisfactory solutions to the persistent  
incidence of bacterial leaf spot; therefore, there  
is a need for alternative management of  
pathogenic Xanthomonas euvesicatoria.  
1
10  
• Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •  
ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of  
mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria  
Xanthomonas euvesicatoria, in order to  
determine the potential of oregano oil as an  
alternative treatment for bacterial spot and its  
feasibility to replace the use of antibiotics and  
pesticides.  
L NaCl and 0.02% Tween 20) for 14 h at 4 °C.  
Then, 0.1 ml of the extract was spread onto two  
plates: Modified Tween medium B (mTMB, per  
liter composition: bacto peptone 10g, H BO  
3
3
0.1g, KBr 10g, CaCl anhydrous 0.25g, bacto  
2
agar 15g, tween 80 10ml, cephalexin 65mg, 5-  
fluorouracil 12mg, trobamycin sulphate 0.2mg,  
nystatin 35mg), and yeast dextrose calcium  
carbonate medium (YDC, per liter composition:  
Materials and methods  
Bacterial strains, isolation and identification  
of Xanthomonas in pepper seeds. Four strains  
of Xanthomonas euvesicatoria were used in this  
study, three from New Mexico, USA, and one  
from Chihuahua, Mexico. The new mexican  
strains were obtained from different farms  
located in New Mexico (kindly provided by Dr. S.  
Sanogo, College of Agricultural and  
Environmental Sciences; Entomology, Plant  
Pathology and Weed Sciences NMSU); these  
strains are named according to the farm from  
which they were isolated (Table 1). The mexican  
strain (Chihuahua, Mexico) was isolated from  
infected jalapeno pepper seed provided by the  
Cuerpo Academico CA-100 from Universidad  
Autonoma de Chihuahua located in Chihuahua  
Mexico.  
yeast extract 10g, CaCO 20g, d-glucose 20g,  
3
bacto agar 17g). It was necessary to dilute the  
extract 1:100 to obtain less than 300 colonies  
per plate. After plates were incubated at 28 °C  
for 5 days, pale yellow, mucoid colonies typical  
of Xanthomonas spp. developed, then they were  
transferred to a new plate of mTMB and isolated  
by the quadrant streaking technique. Isolated  
strains were used for biochemical  
characterization consisting of hydrolysis tests  
(casein, starch, lipids, gelatin, and cellulose),  
catalase production and oxidation/fermentation  
of glucose, lactose, and sucrose. Biochemical  
tests were incubated at 28 °C for 4-7 days, and  
if after 7 days no growth or color reaction was  
observed, the test was considered negative. In  
addition, PCR amplification of the intergenic  
Table 1. Bacterial strains used in this study.  
16S-23S ribosomal gene (Forward primer 5’-  
GTGCCAGCAGCCGCGGTAAT; Reverse  
primer 5’- TACTCCACCGCTTGTGCGGG),  
followed by sequencing (ABI3100) was carried  
out to confirm strain identity. In addition ClustalW  
algorithm was used for multiple sequence  
alignment.  
Strain  
Host  
Location  
Alvarez farm  
Chile pepper  
Chile pepper  
Bell pepper  
La Union, New Mexico  
Chamberino, New Mexico  
Deming, New Mexico  
Chihuahua, Mexico  
Provencio farm  
Kasparian farm  
Tula Seed strain  
Pathogenicity assays were performed using  
the seed isolates. Seedlings of a known  
susceptible jalapeno pepper cultivar (Early  
Jalapeno) were grown under greenhouse  
conditions until the 2-3 true leaf stage (4 weeks  
after germination); a small quantity of the  
selected colonies was transferred to a culture  
tube with 5 ml of nutrient broth; the inoculum  
was adjusted to an optical density of 0.1 at 625  
Jalapeno pepper  
For isolation of the Mexican Tula seed  
pathogen, the standardized method described  
by the International Seed Federation was used  
(
www.worldseed.org). This method focuses in  
the detection of viable Xanthomonas campestris  
pv. vesicatoria (Xanthomonas euvesicatoria) by  
dilution plating of seed extracts on semi-selective  
media, and the confirmation of suspected  
bacterial colonies by a pathogenicity assay. One  
gram of seeds were incubated in 3 ml of seed  
8
nm (ca. 10 CFU/ml).  
Three leaves were infiltrated (1-4 sq cm of  
the surface) with the suspension by gently  
forcing the liquid into the adaxial surface of a  
leaf using a sterile syringe without a needle;  
extraction buffer (0.05M PO buffer pH 7.2; 8.5g/  
4
1
11  
•
Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •  
ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of  
mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria  
sterile distilled water was used for the negative  
control as previously described by the  
International Seed Federation (ISF, http://  
www.worldseed.org/isf/home.html). Inoculated  
plants were incubated in a growth chamber at  
microtiter dish (Corning 96 well plates, Sigma-  
Aldrich, CLS3628). Varying concentrations (but  
constant volumes) of oregano oil were added  
(using five wells per strain); the plates were  
covered and incubated at 37 °C in an orbital  
shaker for 18 h. After incubation, microplates  
were read at 625 nm in a plate reader (Bio-tek  
FL 800). Non-inoculated controls and DMSO and  
methanol blanks were also assayed. Before and  
after exposure to oregano oil, viable plate counts  
on Mueller Hinton Agar were carried out to  
determine the MBC. These experiments were  
repeated three times. The effect of pure  
carvacrol (Carvacrol 98% Sigma-Aldrich No.  
30 °C with 10 h light per day covered with a  
plastic bag to retain and increase the humidity.  
Plants were observed daily for one week looking  
for the presence of chlorotic lesions. Non-  
pathogenic bacteria will produce  
a
hypersensitive reaction in 24 h or will not develop  
lesions at all. This experiment was repeated to  
ensure reproducibility in pathogenicity assays.  
GC-MS analysis of Lippia berlandieri  
essential oil. Oregano essential oil was obtained  
by steam distillation and provided by the Don  
Pablo Licon company located in Chihuahua,  
Mexico. Dry leaves and small stems of L.  
berlandieri were used for oil extraction.  
Components were identified by direct  
comparison with authentic standards (Sigma)  
on the basis of retention time, Kovats retention  
indices, and comparison with literature data  
2
82197) against Xanthomonas euvesicatoria  
strains was also carried out as described above  
with the same number of replications.  
Testing of Lippia berlandieri essential oil’s  
effectiveness in disease protection.  
a) Sources of infested pepper seed: Three  
sets of seed were used (Table 2). The first set  
consisted of naturally infested jalapeno seed  
obtained from the diseased plant variety Tula  
(Cuerpo Academico CA-100 from the  
Universidad Autonoma de Chihuahua). The  
second set, obtained from the cultivar Early  
Jalapeno (Chile Pepper Institute, New Mexico  
State University), was subdivided in two lots, and  
seed in one lot was artificially infected with the  
Mexican strain of X. euvesicatoria isolated from  
the Mexican Tula seed, whereas seed in the  
other lot was artificially infected with a strain from  
New Mexico. Artificially infection of Early  
Jalapeno seeds was carried out based on the  
method proposed by Adam Bognadove, (2011)  
(Adams, 2001).  
Analysis of essential oil was performed by  
gas chromatography coupled to mass  
spectrometry using a CP-3800 Varian GS/MS.  
The GC was equipped with a capillary column  
Saturn 2200 (30 m x 0.25 mm fused silica  
capillary column, film thickness 0.25 mm), and  
Helium was used as a gas carrier at a flow rate  
of 55 ml/min. The GC oven temperature was  
initiated at 60 °C, then increased to 250 °C at a  
rate of 3 °C/minute, and kept constant for 5 min  
at 250 °C.  
(
http://www.reu.iastate.edu/2002/papers/  
Determination of the antibacterial activity of  
Lippia berlandieri essential oil and pure carvacrol.  
The minimum inhibitory concentration (MIC) and  
minimum bactericidal concentration (MBC) of  
essential oil was estimated. Pure bacterial  
cultures were inoculated in 3 ml of Mueller Hinton  
Broth (MHB, which is the medium recommen-  
ded for this assay according to the International  
Seed Federation) for 18 h at 37 °C, the culture  
was adjusted to OD = 0.1 at 625 nm, and 150 μl  
of each culture was added to a sterile 96-  
DerrickBarker.pdf). Bacterial cultures were  
grown in Nutrient Broth at 30 °C for 24 h; after  
which the optical density was measured and  
adjusted to 0.1. One gram of pepper seeds was  
covered with a wet absorbent paper towel for  
three hours using deionized sterile water. Seeds  
were placed in a petri plate and mixed with 2 ml  
of the 0.1 O.D625 bacterial suspension for 25 min;  
this suspension was removed and the seeds  
were allowed to dry for 1 h. The process was  
repeated to ensure successful colonization.  
1
12  
• Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •  
ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of  
mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria  
b) Seed treatment with Oregano oil: In order  
to test the antibacterial activity of oregano oil,  
different treatments were tested including both  
seed and foliar treatments depending on the  
seed variety as indicated in Table 2.  
c) Assessment of treatment efficacy. The  
variables disease severity/incidence index,  
chlorophyll counting units, and matter yield were  
measured to determine the efficacy of oil  
treatment on disease development from  
infested seeds: Disease severity (s) was  
calculated using the Stover and Dickson scale.  
Different grades were assigned to each leaf  
according to the area spotted: grade 1 (< 5%  
area spotted), grade 2 (5-15% area spotted),  
grade 3 (16-33% area spotted), and grade 4 (>  
Table 2. Treatments applied to seeds and plants of jalapeno  
varieties Tula and Early. Note that Tula seeds were already  
infected with a Mexican strain of Xanthomonas.  
Jalapeno  
variety  
Target  
Treatment  
Identity or Procedure  
Inected with aMX strain of  
Xanthomonas  
Tula  
Seeds  
Untreated (infected control)  
33% area spotted). The proportion of diseased  
Seeds  
Seeds  
Bleach (0.57% free chlorine)  
Oregano oil (1 mg/ml)  
Immersed for 20 min  
Immersed for 20 min  
leaves, or disease incidence (I), was calculated  
as the number of diseased leaves divided by  
the total number of leaves in the plant.  
Sprayed at 20 and 50  
days after germination  
Foliar  
Foliar  
Oregano oil (1 mg/ml)  
Oregano oil (0.1 mg/ml)  
Sprayed at 20 and 50  
days after germination  
Chlorophyll was measured using CCM-200  
chlorophyll content meter; each plant was  
divided in three sections, three leaves from each  
section were measured for chlorophyll and three  
measurements from each leaf, corresponding  
to a total of 27 measurements per plant.  
Early  
Seeds  
Seeds  
Seeds  
Untreated (Non-infected control)  
Inoculated with aMX strain  
Inoculated with bNM strain  
-
-
-
a
Inoculated with MX strain and  
Oil sprayed at 20 and 50  
days after germination  
Seeds/Foliar  
Seeds/Foliar  
sprayed w/oregano oil (1 mg/ml)  
Inoculated with bNM strain and  
Oil sprayed at 20 and 50  
sprayed w/oregano oil (1 mg/ml) days after germination  
a
MX strain of Xanthomonas was isolated from Mexican-grown Tula seed.  
NM strain of Xanthomonas was isolated from the Provencia farm, Las  
Results and discussions  
b
Cruces, NM.  
Isolation and identification of Xanthomonas  
euvesicatoria. Biochemical tests were perfor-  
med on yellow mucoid colonies from the YDC  
and mTMB media, and these resulted in positive  
reactions for all bacterial strains (Table 3).  
However, the time required to develop a positive  
reaction was different between strains: Alvarez  
and Kasparian strains developed positive  
biochemical reactions after 6 days of incubation;  
while Provencio and Tula Seed strains developed  
positive reactions after 3 days of incubation.  
Potted Early and Tula Jalapeno were placed  
on a greenhouse bench in a randomized complete  
block design with three replications. Plants were  
covered with a plastic bag after the first foliar  
delivery treatment in order to increase humidity  
to encourage disease development. Plants were  
watered every three days and observed everyday  
to record any disease symptom.  
After symptoms were detected, X.  
euvesicatoria was isolated from diseased leaves  
as follows: Five spots were cut from  
symptomatic leaves with a razor blade and  
macerated with a sterile mortar and pestle in 100  
μl of sterile deionized water. The mixture was  
centrifuged at 800 rpm for 1 min in order to  
precipitate leaf debris and suspend bacterial cells  
in the supernatant. A10 μl aliquot of supernatant  
was streaked on a nutrient agar plate (please,  
describe the composition of nutrient medium).  
Plates were incubated for 5 days at 28 °C.  
Biochemical tests (described previously) were  
carried out for identification of the pathogen.  
Amplification of the intergenic 16S-23S  
ribosomal gene was carried out for all  
presumptive xanthomonad strains, and the  
presence of a 430 bp band was the first step  
towards sequencing. BLAST results revealed that  
X. euvesicatoria (no. GeneBank AM039952.1)  
was a common match at the highest similarity  
(98%) for all the isolates. Partial sequence of the  
intergenic region was used to compare isolate  
distribution (http://www.ebi.ac.uk/Tools/clustalw2/  
index.html), and all the strains were unique from  
each other (data not shown).  
1
13  
•
Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •  
ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of  
mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria  
Table 3. Biochemical tests for the different Xanthomonas  
euvesicatoria strains (W indicates a weak positive test).  
In vitro determination of antibacterial activity  
of Lippia berlandieri essential oil. Minimum  
inhibitory (MIC) and bactericidal (MBC) activities  
Xanthomonas euvesicatoria strains  
X. euvesicatoria  
Characteristic  
were determined for each strain of X.  
euvesicatoria. Bactericidal effects were  
observed at higher concentrations (0.05 mg/ml)  
whereas inhibition of growth (MIC) was observed  
at concentrations of 0.01 mg/ml (Table 4) and  
repeated experiments showed similar results.  
(19)  
Alvarez  
Provencio  
Kasparian  
Tula  
Medium yellow  
mucoid circular  
colonies, the halo  
was absent.  
Large yellow mucoid circular colonies, a  
small crystalline halo around the yellow  
colony was present.  
Morphology in  
mTMB media  
Morphology in YDC  
media  
Medium yellow mucoid circular colonies.  
Gram stain  
Catalase production  
Hydrolysis tests:  
Casein  
Gram-negative  
+
Gram-negative rods of 2 m in size, commonly in pairs.  
The effect of pure carvacrol on two different  
X. euvesicatoria strains was tested (Provencio  
and Tula). Interestingly, its antibacterial effect  
was not as potent as oregano oil, despite the  
fact that the oregano oil was measured to have  
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
Starch  
+
Lipids  
W
+
W
+
W
W
W
3
0% of carvacrol content according to the GC/  
MS data.  
In vivo (in the plant host) determination of  
Gelatin  
Cellulose  
+
+
O/F basal medium  
Hugh Leifson)  
(
antibacterial activity of Lippia berlandieri  
Glucose oxidation  
Lactose Oxidation  
Sucrose Oxidation  
Glucose  
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
essential oil. Early jalapeno and Tula jalapeno  
nd  
varieties were planted on December 2 2007  
+
+
+
following the seed treatments and foliar  
applications described before. Plants were  
examined three times per week for disease  
symptoms, including chlorotic or necrotic zones  
in leaves. The data collected is presented based  
in observations of the leaves in each plant; total  
number of diseased leaves were counted and  
classified according to the severity of the disease  
based on the parameters used by Chuang, 1987.  
W
W
W
W
W
W
Fermentation  
Lactose  
Fermentation  
+
W
W
W
+
Sucrose  
Fermentation  
Four weeks after germination, Early variety  
of Jalapeno was inoculated with the four  
xanthomonad isolates, but only two strains,  
Provencio andTula, caused symptoms one week  
after inoculation (Figure 1). The other two strains  
and negative controls showed no symptoms.  
Both virulent strains were re-isolated and verified  
to be xanthomonads by biochemical tests.  
To calculate the amount of leaf spot disease  
severity (s) the modified Stover and Dickson  
scale (Chuang and Jeger, 1987) was used:  
s = (0.05x + 0.15y + 0.35z + 0.25 w) / n  
in which x, y, z, and w represent the number  
of leaves with disease grades 1, 2, 3 and 4  
respectively, and n is the total number of leaves.  
GC-MS analysis of Lippia berlandieri  
essential oil.  
Essential oil was analyzed with the purpose  
of detecting the different components that were  
present in the oregano oil; the chromatogram  
The disease incidence (I), was calculated  
as the number of diseased leaves divided by  
the total number of leaves on the plant. Results  
are summarized in Figures 3 and 4. When  
severity indices are calculated, the range can  
vary from 0 (absence of spots in the leaves) to  
0.15 (medium severity/incidence index);  
incidence varied from 0 (no diseased leaves)  
(Figure 2) showed the seven major peaks that  
represent the most prevalent components in the  
essential oil. Total running time in the GS-MS  
was of 63.3 min. The analysis was performed  
in triplicate to ensure analytical repeatability.  
1
14  
• Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •  
ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of  
mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria  
Table 4. MIC and MBC of different Xanthomonas euvesicatoria  
strains when exposed to different concentrations of oregano  
to 0.5 (the most severe index). When Early  
jalapeno variety was inoculated with either the  
(Lippia berlandieri) essential oil and carvacrol.  
xanthomond isolates from Provencio, NM or  
from Tula, plants exhibited disease symptoms  
aMIC*  
(mg/ml)  
aMBC**  
(mg/ml)  
X. campestris  
strains  
Agent  
(
Figure 4). When inoculated plants were  
Alvarez  
Oregano oil  
Oregano oil  
0.01+0.005  
0.01+0.004  
0.05+0.005  
0.05+0.006  
sprayed twice with 1 mg/mL oregano oil (20  
and 50 days post germination), disease  
incidence and severity both significantly  
dropped (Figure 4). The Tula jalapeno variety  
developed bacterial spot symptoms without  
inoculation due to the seeds already being  
infected with Xanthomonas (Figure 5). When  
oregano oil was applied to either the Tula seed  
or to the foliage, disease symptoms decreased  
significantly (Figure 4).  
Provencio  
Oregano oil  
Carvacrol  
0.01+0.004  
0.10+0.020  
0.05+0.006  
1.00+0.082  
Kasparian  
Tula  
Oregano oil  
Carvacrol  
0.01+0.00  
0.05+0.005  
1.5+0.064  
0.10+0.0304  
a
*
Values represent the means of three separate experiments  
with + one standard deviation shown.  
Significant inhibitory effect (p<0.01).  
*
Significant bactericidal effect (p<0.001).  
*
Figure 1. Pathogenicity assay. A=Alvarez strain, B=Kasparian strain, C=Provencio strain, D=Tula. Arrows indicate  
the leaf that was inoculated.  
1
15  
•
Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •  
ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of  
mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria  
Figure 2. Chromatogram of the oregano essential oil: «x» axes  
indicates the retention time and «y» axes indicates the peak  
height in K counts. Numbers indicate the analytes detected  
oregano-treated plants (Figure 5). For example,  
when the Early variety was infected with either  
according to the retention time: Cyclohexene-1-methyl-4-  
cymene (1), Cymeole (2), Carvacrol (3), Caryophyllene (4),  
Caryophyllene oxide (5), Alpha-terpinene (6), 3-Carene (7).  
Retention times matched with separately run standards, and  
the mass spectra matched those in the Adams 2001 library.  
the Tula or Provencio strain, chlorophyll content  
decreased by a factor of 3, and when plants  
were foliar treated with oil, chlorophyll content  
increased to control levels in a two-fold order  
(Figure 5A). Similar results were observed with  
the Early variety (Figure 5B).  
Figure 4. Severity and Incidence indices when Tula jalapeno  
variety was treated with oregano oil. Values represent the  
means of three replicates, and error bars represent one  
standard deviation.  
Figure 3. Severity and Incidence indices when Early jalapeno  
variety was inoculated with Xanthomonas and then treated  
with oregano oil. Values represent the means of three  
replicates, and error bars represent one standard deviation.  
*
*
Significant effect on Foliar treatment with 1 mg/ml when  
comparing with controls (untreated seed and seed treated  
with bleach) and foliar treatment at 0.1 mg/ml (p<0.01).  
* Significant effect on Seeds treated with oregano oil when  
compared with controls and foliar treatments (p<0.01).  
Bacterial spot disease along the U.S.-  
Mexican border in peppers and tomato has  
represented a major problem in the last decade  
causing crop losses with a serious economic  
impact on producers. One of the goals of this  
study was to isolate the causal agent of a spot  
disease in pepper seeds, using the method  
proposed by the International Seed Federation,  
which involves the use of semi-selective media  
*
Significant difference between infected plants and infected  
plants that were foliar-treated (p<0.01).  
In this greenhouse study, chlorophyll  
content decreased by xanthomonad infection,  
and chlorophyll content was maintained in  
1
16  
• Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •  
ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of  
mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria  
and pathogenicity assays. Several methods  
have been proposed as means for identification  
X. euvesicatoria; one of which (Alvarez et al.,  
using these techniques X. euvesicatoria was  
isolated from the seeds and verified to be the  
causal agent of the disease.  
1
985) consists in producing monoclonal  
Two other bacteria are likely to cause similar  
symptoms to the ones caused by Xanthomonas  
and biochemical tests are helpful to differentiate  
them. Pseudomonas is an oxidative non-  
fermentative bacterium, so the positive sugar  
fermentations were helpful in eliminating this  
possibility. Xylella has protease activity (capable  
to hydrolyze casein and gelatin) (Fedatto, 2006),  
the difference with Xanthomonas is that it is non  
motile, does not ferment glucose and does not  
produce lipase.  
antibodies (MCAs) that rapidly identifies X.  
campestris pv vesicaria from other pathovars.  
In a different approach (17), X. campestris pv  
campestris was detected using immuno-  
fluorescence microscopy when polyclonal and  
monoclonal antibodies were produced from  
flagellar extracts, however, both methods  
produced cross-reactivity with different non-  
xanthomonad strains and with different  
pathovars. Specific primers that detect specific  
genes in the pathogen represent a promising  
method. In this study, the amplification of the 16S  
intergenic space sequences was used in  
combination with sequence data, biochemical  
tests, and the isolation protocol proposed by the  
International Seed Federation. The combined  
approach resulted in isolation and identification  
of xanthomonads and allowed their screening  
for virulence on pepper plant hosts. Tula variety  
seeds were obtained during a Mexican outbreak  
of bacterial spot on infected pepper plants, and  
According to the results obtained in the  
present investigation, among monoterpenes and  
aromatic hydrocarbons detected in oregano oil,  
cyclohexene-1-methyl-4-cymene was predominant  
which was expected since it is a precursor of  
carvacrol and thymol. Although carvacrol and  
cymene were the major essential oil  
components, 1-8-cineole and alpha-terpinene  
were also present, consistent with other results  
reported (Duschastki et al., 1999).  
Figure 5. Chlorophyll content in infected Tula jalapeno variety (A) and in Early variety inoculated with the Tula and Provencio  
xanthomonads (B), and effect of foliar and seed-applied oregano oil. Values represent the mean of three replicates, and standard  
deviations were calculated using the unbiased estimator for the mean.  
1
17  
•
Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •  
ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of  
mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria  
It has been reported that various agronomic  
conditions such as duration of daylight,  
temperature, water stress, and the plant growth  
phase affect the development of the oregano  
plant and its essential oil composition  
diseases in plants, we depend on symptoms  
and signs of the disease that can be measured  
with different parameters described before  
(severity/incidence indices, chlorophyll amount,  
and dry weight).  
(
Velasquez-Valle and Amador-Ramirez, 2007).  
Seeds of the Early variety of jalapeno were  
pathogen-free and were infected with strains that  
exhibited virulence in both jalapeno and bell  
peppers. The varieties were chosen for two  
reasons: the first one was in order to test if the  
method used to infect Early jalapeno seeds was  
successful, and the second reason was to  
compare if the treatments for avoiding disease  
worked in both varieties.  
For instance, water stress decreased fresh  
weight and oil content while increasing thymol  
and carvacrol content in the oil obtained from  
Origanum vulgare species; flowering also  
increased the oil yield (Stover and Dickson, 1970;  
Vernin et al., 2001); young plants have a higher  
amount of thymol whereas older plants have a  
higher content of carvacrol (Stover and Dickson,  
1
970). According to GC/MS analysis of this  
Among the two types of infected seeds, the  
incidence/severity indices were similar for both  
native-infected seeds (Tula variety) and  
inoculated (Early variety) with two different  
strains, Early jalapeno inoculated with both  
pathogenic strains, showed lower incidence/  
severity indices than the already infected Tula  
jalapeno when foliar treatment at the same  
concentrations was applied.  
study, carvacrol content in he oregano oil sample  
corresponded to 30% (v/v) which is a significantly  
higher amount when compared with essential  
oil obtained from Origanum spp.  
Previous work has demonstrated the  
efficacy of oregano oil as antimicrobial, and most  
of these studies have focused on the food  
industry, testing the effects against some food-  
borne pathogens as well as other human  
pathogens (Aureli et al., 1992; Biondi et al.,  
It can also be stated that the effect of the  
extract is more effective at the seed level because  
once the disease is present in adult plants; the  
pathogen can be more resistant to treatment and  
more difficult to control. It is also more convenient  
in the sense that it does not consume as much  
time as foliar treatment, and it is performed only  
once with less quantity of essential oil.  
1
993; Force et al., 2000; Baricevic et al., 2001;  
Arcila-Lozano et al., 2004; Chorianoupolos et al.,  
004; O’Mahony et al., 2005; Chorianoupolos et  
2
al., 2006). Nevertheless, few studies have  
considered the potential effect expected of  
oregano essential oil against animal or plant  
pathogens, specifically using Lippia essential oil  
or other oregano-like plants.  
When emphasizing strain virulence, as  
observed in Figure 3, it seems that infection with  
the Provencio isolate produces higher severity/  
incidence than infection with the Tula seed isolate  
for that particular variety of jalapeno; however,  
to control both pathogens the single oil  
concentrations appears to be equally effective  
in eliminating pathogenesis, which indicates the  
broad effectiveness of the oregano oil. Since  
Xanthomonas euvesicatoria produces chlorosis  
in leaf tissue, chlorophyll content was an  
effective parameter to track infection. Chlorophyll  
content changes represent both plant  
xanthomonad infection and plant recovery due  
to oregano oil treatment.  
The concentration of oregano oil that is  
needed to inhibit bacterial growth (MIC) and to  
kill 99% of bacterial cells (MBC) is surprisingly  
low, while the effect of pure phenol carvacrol is  
not as effective as the oil (Table 4); this suggests  
that the components found in oregano oil act  
synergistically to potentially increase the  
antimicrobial effect. Future studies are required  
to test this hypothesis.  
A plant disease, in its broad sense, is any  
growth or developmental condition that is not  
«normal» to that plant and can usually reduce  
its economic or aesthetic value (Sanogo and  
Clary, 2005). For a presumptive diagnosis of  
1
18  
• Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •  
ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of  
mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria  
In summary, Koch’s postulates were proven  
in that a xanthomonad was isolated from infected  
seed (Tula), was inoculated on to healthy plants,  
References  
ABBASI, P.A., N. Soltani, D.A. Cuppels. and G. Lazarovitz. 2002.  
Reduction of bacterial spot disease severity on tomato and  
causing disease, and was re-isolated. Oregano  
oil showed great in vitro activity against the strains  
of Xanthomonas used in this study, with MICs  
averaging 0.01 mg/ml. Surprisingly, the oregano  
oil (with 30% carvacrol content) was significantly  
more potent than a commercial source of  
carvacrol (98%), indicating that in oregano  
essential oil there are other components that work  
synergistically with carvacrol. This study is the  
first to show the effectiveness of oregano oil in  
controlling bacterial spot disease in peppers, and  
emphasizes the importance of natural treatments  
in crop production that could replace toxic and  
ineffective alternatives.  
pepper plants with foliar applications of ammonium  
lignosulfonate and potassium phosphate. Plant Disease.  
8
6(11): 1232-1236.  
ADAMS, R.P. 2001. Identification of essential oil components by  
gas chromatography/quadrupole mass spectroscopy. Allured  
Publishing Corporation, Carol Stream, Illinois. 175 p.  
ALVAREZ, A.M., A.A. Benedict, and C.Y. Mizumoto. 1985.  
Identification of xanthomonads and grouping of strains of  
Xanthomonas campestris pv. campestris with monoclonal  
antibodies. Phytopathology. 75(6): 722-728.  
ANDRADE, E., L.P. Silva, J.L. Pereira, E.F. Noronha, F.B. Reis, C.  
Bloch, M.F. Dos Santos, G.B. Domont, O.L. Franco, and A.  
Mehta. 2008. In vivo proteome analysis of Xanthomonas  
campestris in the interaction with the host plant Brassica  
oleracea. FEMS. 28(2):167-174.  
ARCILA-LOZANO, C., G. Loarca-Pina and S. Lecona-Uribe. 2004. El  
orégano: propiedades, composición y actividad biológica de  
sus componentes. ALAN. 54(1):100-111. ISSN 0004-0622.  
AURELI, P., A. Costantini and S. Zolea. 1992. Antimicrobial activity  
of some essential oils against Lysteria monocytogenes. Food  
Protection 55(5):334-348.  
BARICEVIC, D., L. Milevoj and J. Borstnik. 2001. Insecticidal effect of  
oregano (Origanum vulgare) on the dry bean weevil  
Acanthoscelides obtectus. Horticultural Science. 7(2):84-88.  
Conclusions  
The phytopathogen X. euvesicatoria was  
identified by a simple method in infected seeds  
and leaves of jalapeno. We examined the  
antibacterial activity of oregano oil against strains  
of X. euvesicatoria from different origins. The  
susceptibility of the plant pathogen was more  
remarkable in the seed treatment, but it was also  
efficient in higher concentrations when a foliar  
application was performed. Among the  
antimicrobial compounds identified, carvacrol  
predominated in the oil composition; however,  
when antibacterial test were performed with pure  
carvacrol, oregano oil demonstrated a higher  
antibacterial activity. Mexican oregano oil has  
proven to be effective and it is a potential  
candidate for future studies of synergism,  
compatibility and activity in other pathogens  
BIONDI, D., P. Cianci, C. Geraci, G. Ruberto and M. Piattelli. 1993.  
Antimicrobial activity and chemical composition of essential  
oils from Sicilian aromatic plants. Flavour and fragrance.  
8(6):331-337.  
BOGDANOVE, A.J., Koebnik, R., Lu, H., Furutani, A., Angiuoli, S.V.,  
Patil, P.B., Van Sluys, M.A., Ryan, R.P., Meyer, D.F., Han, S.W.,  
Aparna, G., Rajaram, M., Delcher,A.L., Phillippy,A.M., Puiu, D.,  
Schatz, M.C., Shumway, M., Sommer, D.D., Trapnell, C.,  
Benahmed, F., Dimitrov, G., Madupu, R., Radune, D., Sullivan,  
S., Jha, G., Ishihara, H., Lee, S.W., Pandey, A., Sharma, V.,  
Sriariyanun, M., Szurek, B., Vera-Cruz, C.M., Dorman, K.S.,  
Ronald, P.C., Verdier, V., Dow, J.M., Sonti, R.V., Tsuge, S.,  
Brendel, V.P., Rabinowicz, P.D., Leach, J.E., White, F.F., and  
Salzberg, S.L. (2011). Two new complete genome sequences  
offer insight into host and tissue specificity of plant pathogenic  
Xanthomonas spp.Journal of Bacteriology. 193: 5450-5464  
BOUZAR, H., J.B. Jones, R.E. Stall, N.C. Hodge, G.V. Minsavage,  
A.A. Benedict andA.M.Alvarez. 1994. Physiological, chemical,  
serological and pathogenic analyses of a worldwide collection  
of Xantomonas campestris pv. vesicatoria strains.  
Phytopathology. 84(22): 663-671.  
(human, plant or animal).  
Aknowledgements  
CHORIANOUPOLOS, N., E. Kalpoutzakis, N. Aligiannis, S. Mitaku, G.J.  
Nychas andA.S. Haroutounian. 2004. Essential oils of Satureja,  
Origanum, and Thymus species: chemical composition and  
antibacterial activities against foodborne pathogens.  
Agricultural and Food Chemistry 52(26): 8261-7.  
CHORIANOUPOLOS, N., E. Evergetis,A. Mallouchos, E. Kalpoutzakis,  
G.J. Nichas and A.S. Haroutonian. 2006. Characterization of  
the essential oil volatiles of Saruteja thymbra and Saruteja  
parnassica: influence on harvesting time and antimicrobial  
activity. Agricultural and Food Chemistry. 54(8): 3139-45.  
CHUANG, T.Y., and M. Jeger. 1987. Relationship between incidence  
and severity of banana leaf spot in Taiwan. Phytopathology  
We thank Bertha Rivas-Lucero, Stephen  
Hanson, Andrea Colleman, Rio Stamler, Jeanne  
Curry, Richard Richins and Mary O’Connell for  
valuable help in biochemical, microbiological and  
molecular techniques. We acknowledge Paul  
Bosland and the Chile pepper institute for providing  
uninfected pepper seeds (early variety). We also  
thank the Pablo Licon industry for providing high  
quality oregano essential oil for this study.  
77: 1537-1541.  
1
19  
•
Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •  
ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of  
mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria  
DORMAN, H.J., and S.G. Deans. 2000. Antimicrobial agents from  
plants: antibacterial activity of plant volatile oils. Applied  
Microbiology. 88(2): 308-16.  
POHRONESNY, K., M.A. Moss, W. Dankers and J. Schenk. 1990.  
Dispersal and management of Xanthomonas campestris pv  
vesicatoria during thinning of direct-seed tomato. Plant  
Disease 74:800-805.  
DUSCHASTKI, C., P. Bailac, A. Carrascull, N. Firpo and M. Ponzi.  
1
999. Composicion de los aceites esenciales de Lippia  
PORTILLO-RUIZ, M., S. Viramontes, L. Munoz, M. Gastelum and G.V.  
Nevarez. 2005. Antifungal activity of mexican oregano Lippia  
berlandieri shauer. Food Protection 68(12):2713-2717.  
jeneillana, L. integrifolia, L. Turbinata de la provincia de San  
Luis en Argentina. Rev Colombiana de Química. 27:9-16.  
ELGAYYAR, M., and F.A. Draughon. 2001. Antimicrobial activity of  
essential oils from plants against selected pathogenic and  
saprophytic microorganisms. Food Protection 64(7):1019-24.  
FORCE, M., W.S. Sparks, and R.A. Ronzio. 2000. Inhibition of enteric  
parasites by emulsified oil of oregano in vivo. Phytotheraphy  
Research. 14(3): 213-4.  
SANOGO, S., and M. Clary. 2008. Bacterial leaf spot of Chile  
peppers: A short guide for growers. New Mexico Chile  
Association Report. 40 p.  
STOVER, R.H., and J.D. Dickson. 1970. Leaf spot on bananas caused  
by Mycosparella musicola: Methods of measuring spotting  
prevalence and severity. Tropical Agriculture. 47:289-302.  
VALERO, M., and M.C. Salmeron. 2003. Antibacterial activity of 11  
essential oils against Bacillus cereus in tyndallized carrot broth.  
International Journal Food Microbiology. 85(1-2):73-81.  
FRANKEN, A.A., J.F. Zilverentant, P.M. Boonekamp, andA. Schots.  
1991. Specificity of polyclonal and monoclonat antibodies for  
the identification of Xanthomonas campetris pv campestris.  
European Plant Pathology. 98(2): 81-94.  
FEDATTO, L.E. 2006. Detection and characterization of protease  
secreted by the plant pathogen Xylella fastidiosa.  
Microbiological Research. 161(3):263-272.  
TREBAOL, G., Gardan L., Manceau C., Tanguy J., Tirilly Y., and  
Boury S. 2000. Genomic and phenotypic characterization of  
Xanthomonas cynarae sp. nov., a new species that causes  
bacterial bract spot of artichoke (Cynara scolymus L.).  
International Journal of Systematic and Evolutionary  
Microbiology. 50:1471-1478.  
JI-LIANG, Z., and C.S. Orser. 2004. Conserved repetition in the ice  
nucleation gene inaX from Xanthomonas campestris pv.  
transluscens. Molecular and General Genetics. 223(1):1432-  
VELASQUEZ-VALLE, R., and M.D. Amador-Ramirez. 2007. Análisis  
sobre la investigación fitopatogénica de chile seco (Capsicum  
annuum L.), realizada por el Instituto Nacional de  
Investigaciones Forestales, Agrícolas y Pecuarias de los  
estados de Aguascalientes y Zacatecas, México. Revista  
Mexicana de Fitopatología. 25(1): 80-84.  
VELDHUZEN, E.J.A., B. Tjeerdsma-Van, C. Zweijtzer, S.A. Burt and  
H.P. Haagsman. 2006. Structural requirements for the  
antimicrobial activity of carvacrol. Agricultural and Food  
Chemistry 54: 1874-1879.  
VERNIN, G., C. Lageot, E.M. Gaydouz and C. Parkanyi. 2001.  
Analysis of the essential oil of Lippia graveolens from El  
Salvador. Flavor and Fragrance. 16: 219-226.  
1
874.  
KUFLOM, M. K., andA.C. Diane. 1997. Development of a Diagnostic  
DNA Probe for Xanthomonads Causing Bacterial Spot of  
Peppers and Tomatoes. Applied and Environmental  
Microbiology 63(11): 4462-4470.  
O’MAHONY, R., H. Al-Khtheeri, D. Weerasekera, N. Fernando, D.  
Vaira, J. Holton, and C. Basset. 2005. Bactericidal and anti-  
adhesive properties of culinary and medicinal plants against  
Helicobacter pylori. World Journal of Gastroenterol. 11(47):  
VORHOLTER, F.J., S. Schneiker, A. Goesmann, L. Krause, T. Bekel,  
O. Kraiser, B. Linke, T. Patshkowski, C. Ruckert, J. Schmid, K.  
Sidhuv, V. Sieber,A. Tauch, S.A. Watt, B. Weisshaar,A. Becker,  
K. Niehaus andA. Puhler. 2008. The genome of Xanthomonas  
campestris pv. campestris and its use for the reconstruction  
of methabolic pathways involved in xanthan biosynthesis.  
Biotechnology 134(1-2):33-45.  
7
499-507.  
Este artículo es citado así:  
Chavez-Dozal, A., H. A. Morales-Morales, S. Sanogo,A. Segovia-Lerma and G. B. Smith. 2014. Antibacterial  
activity of mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium  
Xanthomonas euvesicatoria. TECNOCIENCIA Chihuahua 8(2): 109-121.  
1
20  
• Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •  
ALBA CHAVEZ-DOZAL, HUGO A. MORALES-MORALES, SOUM SANOGO, ARMANDO SEGOVIA-LERMA AND GEOFFREY B. SMITH: Antibacterial activity of  
mexican oregano essential oil (Lippia berlandieri) against the phytopathogenic bacterium Xanthomonas euvesicatoria  
Resumen curricular del autor y coautores  
GEOFFREY BATTLE SMITH. Realizó sus estudios de licenciatura en Biología e Inglés en el Pitzer College, en Claremont, California, USA.  
Obtuvo su grado de maestría en ciencias en la University of Kentucky, y su grado doctoral en Ciencias de Suelos en North Carolina  
State University. Posee un grado post-doctoral de la Michigan State University. Inició como profesor de Microbiología en la New  
Mexico State Universtiy (NMSU) en 1991, en donde imparte las asignaturas de Microbiología General y Microbiología Ambiental.  
Realizó un año sabático en 1996 en la Universidad Autónoma de Guadalajara, Jalisco, México donde trabajó en el campo de  
biorremediación. Como asesor principal de tesis, ha supervisado y graduado a diez estudiantes doctorales y a veintidós de  
maestría en ciencias, con quienes ha publicado diversos artículos científicos relativos a la recuperación de suelos por biorremediación  
y monitoreo de variables ambientales microbiológicas de gran importancia para la sanitización de agua y suelos contaminados con  
microorganismos patógenos y compuestos tóxicos. Es miembro de varias sociedades científicas como la Sociedad Americana de  
Microbiología (ASM), USA, desde 1997 a la fecha. Es el líder desde 2005 de la red internacional de colaboración con el Cuerpo  
Académico UACH-CA-100 "Transferencia Tecnológica" adscrito a la Universidad Autónoma de Chihuahua, con quienes ha  
compartido la co-autoría en diversos temas para la su publicación en reuniones científicas. Actualmente realiza actividades de  
colaboración internacional en la validación de las propiedades antimicrobianas de extractos vegetales para su aplicación en la  
agricultura sustentable.  
SOUM SANOGO. El Dr. Sanogo es Profesor Asociado del Departamento de Entomología, Patología y Malezas en la New Mexico State  
University, Las Cruces, NM. Graduado en Pennsylvania State University. Su línea de investigación es la etiología de enfermedades,  
ecología y epidemiología de patógenos del suelo, especialmente hongos y oomycetos, así como control de enfermedades, incluyendo  
biofungicidas, uso de extractos vegetales y pruebas de resistencia a enfermedades. El Dr. Sanogo trabaja cultivos como chile,  
cacahuate, alfalfa y otros de menor cobertura en el Estado de Nuevo México, imparte dos asignaturas "Biología de hongos" y  
"diagnóstico de enfermedades vegetales". Es autor principal en varios artículos científicos y pertenece a diferentes sociedades  
científicas de su área, como la American Phytopathological Society, Crop Science Society of America y la American Peanut  
Research and Education Society. Es miembro de la red internacional de colaboración con el Cuerpo Académico UACH-CA-100  
"Transferencia Tecnológica" adscrito a la Universidad Autónoma de Chihuahua, con quienes ha compartido la co-autoría en  
diversos temas para la su publicación. Actualmente realiza actividades de colaboración internacional con el UACH-CA-100 en la  
validación de las propiedades antimicrobianas de extractos vegetales para su aplicación en la agricultura sustentable en cultivos  
hortícolas de Nuevo México, USA y en la Región Centro-sur de Chihuahua.  
ALBA ARCELIA CHÁVEZ DOZAL. Terminó su licenciatura en el año de 2004, titulándose como Química Bacterióloga Parasitóloga por la  
Facultad de Ciencias Químicas de la Universidad Autónoma de Chihuahua (UACH). Realizó su posgrado en Estados Unidos en la  
Universidad Estatal de Nuevo México (NMSU), donde obtuvo el grado de Maestro en Ciencias en el área Microbiología en 2008 y el  
de Doctorado en 2012. Su área de especialización es la genética bacteriana específicamente dirigida a desarrollo de infecciones.  
Ha asesorado y dirigido 4 tesis de licenciatura y ha publicado 6 artículos científicos; ha impartido tres clases de Microbiología Médica  
y presentado su investigación en 15 conferencias nacionales e internacionales. Es miembro activo de la Asociación Americana de  
Microbiología y ha sido reconocida y apoyada por asociaciones nacionales como "RISE for the postdoctorate", "The Society for  
Advancing Chicanos and Native Americans in Science (SACNAS)" y "National Aeronautics and Space Administration (NASA)".  
ARMANDO SEGOVIA LERMA. En el año 1984, obtuvo el título de Ingeniero Agrónomo Fitotecnista por la Facultad de Ciencias Agrícolas y  
Forestales (FCAyF) de la Universidad Autónoma de Chihuahua (UACH). Le fue conferido el grado de Maestro en Ciencias,  
especialidad Genética, por el Colegio de Posgraduados de Chapingo, México (hoy COLPOS, Montecillo, Estado de México). Realizó  
estudios de doctorado en la Universidad Estatal de Nuevo México (NMSU) recibiendo en el año 2000 su grado de Doctor of  
Philosophy con especialidad en Mejoramiento Genético. El Dr. Segovia fundó en 1989 el Programa de Mejoramiento Genético de  
Hortalizas de la FCAyF-UACH, donde dirige la línea de investigación "Mejoramiento Genético y Producción de Semillas de Hortalizas".  
Es obtentor de la variedad de cebolla de día corto "Mariana-UACH-92" y de variedades de: sandía, chiles para consumo en seco y  
jalapeño (en trámite de registro ante SNICS-SAGARPA). Por su desempeño profesional, como Maestro e Investigador a favor del  
Agro Chihuahuense, recibió un reconocimiento de la Confederación Mexicana Agronómica y el Colegio de Ingenieros Agrónomos de  
Chihuahua. Durante el periodo 1991-1994, recibió el reconocimiento como Candidato a Investigador por el Sistema Nacional de  
Investigadores (S.N.I.) y como Investigador Nivel I desde el año 2006. El Dr. Segovia es Maestro de Tiempo Completo de la FCAyF  
donde ha impartido cursos de Genética y Estadística en licenciatura y posgrado.  
HUGO ARMANDO MORALES MORALES. Cursó la licenciatura en la Facultad de CienciasAgrícolas de la UniversidadAutónoma de Chihuahua  
(
UACH), otorgándosele en 1984 el título de Ingeniero Agrónomo, especialidad Fitotecnia. Realizó estudios de posgrado en la  
Facultad de Ciencias Agrícolas y Forestales de la UACH, obteniendo en el año de 1997 el grado de Maestro en Ciencias en la  
especialidad de Horticultura y Agronegocios. Posee el Doctorado en Ciencias Biológicas, con un mayor en Microbiología Ambiental,  
grado conferido en 2003 por New Mexico State University NMSU), USA. Desde el año 1984 se desempeña como Maestro de Tiempo  
Completo en la UACH y ha sido miembro del CuerpoAcadémico Transferencia de Tecnología desde 2006, año a partir del cual recibió  
el reconocimiento como Perfil PROMEP. Colabora en un proyecto de investigación bilateral en red con investigadores de la New  
Mexico State University desde el año 2005; además, cultiva la línea de investigación: "Agricultura sustentable" y es responsable  
técnico de varios proyectos de investigación con financiamiento externo (Fundación Produce, FOMIX Chihuahua, UACH). A lo largo  
de su vida profesional ha participado como ponente en congresos científicos nacionales e internacionales, y publicado como autor  
y coautor, varios artículos en revistas científicas y de divulgación.  
1
21  
•
Vol. VIII, Núm. 2 • Mayo-Agosto 2014 •